Некоторые генетические аспекты аллергодерматозов на примере анализа мутаций R501X и 2282del4 гена FLG

страницы: 104-106

М.И. Зуева, Н.Н. Иванова, к.хим.н., зав. лаб. молекулярной генетикиГУ «Институт дерматологии и венерологии НАМН Украины», г. Харьков

Zueva_Ivanova_1_Spec_2012.jpg

В последние годы в мире отмечается значительный рост частоты и распространенности аллергических заболеваний кожи, к которым относятся атопический и аллергический дерматиты, экзема. По данным различных авторов, аллергодерматозы составляют до 20% всех аллергических заболеваний (Бакстон, 2005). Также наблюдается нарастание тяжести течения и усиление невосприимчивости данной патологии к проводимой терапии. Несмотря на многочисленные исследования, этиология и патогенез аллергодерматозов во многом еще остаются неясными, однако очевидным является то, что кроме влияния внешних факторов, обусловливающих их развитие, важное значение имеет генетическая составляющая. Именно нарушения в генетическом аппарате, скорее всего, и запускают патологический воспалительный процесс в коже. Показано, что особенно высокие показатели генетической предрасположенности к аллергии отмечаются у пациентов с атопическим дерматитом (АД; Бакстон, 2005; Walley, et al., 2001; Elias, Schmuth, 2009).

Одним из генов, контролирующих различные процессы в коже, является ген FLG (filaggrin), расположенный в хромосоме 1, локус q21.3. Изменения в данном гене вызывают развитие ряда заболеваний, связанных с нарушением барьерной функции кожи (ихтиоз, экзема, АД и другие аллергодерматозы; Hubiche, et al., 2007; Meyer-Hoffert, 2009). Данный ген кодирует белок-предшественник профилаггрин (филамент-агрегирующий белок), который позже разрезается протеазами на мономеры филаггрина, каждый из которых состоит из 324 аминокислот массой 37 кДа. Профилаггрин входит в состав кератогиалиновых гранул кератиноцитов гранулярного слоя эпителия и выполняет одну из ключевых функций в дифференцировке кератиноцитов и превращении их в ороговевшие чешуйки. Филаггрин связывается с цитоскелетом кератиноцитов и участвует в формировании кожного барьера. Кроме того, белок FLG после распада на гидрофильные аминокислоты участвует в поддержании водного баланса кожи. Мутации с потерей функции в гене FLG приводят к терминации экспрессии белка. Это нарушает барьерную функцию кожи, делает ее более чувствительной к воздействию неблагоприятных факторов внешней среды и может приводить к возникновению аллергодерматозов (Howell, et al., 2007; Palmer, et al., 2006; Sandilands, et al., 2009).

Особое внимание уделяется, в частности, двум мутациям в 3-м экзоне гена FLG – 2282del4 и R501X. Первая – делеция (выпадение четырех нуклеотидов) – приводит к сдвигу рамки считывания, вторая – транзиция 1501 С-to-T – к появлению стоп-кодона на 107 нуклеотидов ниже (Sandilands, et al., 2009).

Цель данной работы: проанализировать наличие мутаций 2282del4 и R501X в 3-м экзоне гена FLG у больных с аллергодерматозами и у здорового населения Харьковской области.

Материалы и методы исследования

Обследованы 262 больных с аллергодерматозами в возрасте от 16 до 82 лет, находившихся на лечении в отделении дерматологии ГУ «Институт дерматологии и венерологии АМН Украины». Среди них пациенты с экземой – 177 человек (85 женщин и 92 мужчины), АД – 45 (30 женщин и 15 мужчин), аллергическим дерматитом – 36 человек (25 женщин и 11 мужчин). Контрольную группу составили 96 человек в возрасте от 16 до 80 лет (37 мужчин и 59 женщин) без признаков аллергодерматозов. Образцы крови здоровых людей собраны в Харьковском областном центре службы крови.

Исследование генотипов по гену FLG проводили методом анализа полиморфизма длины рестрикционных фрагментов (ПДРФ), выделение ДНК – фенольным методом из лейкоцитов периферической крови по методике Маниатис и др. (1984). Для выявления мутаций использовали метод ПЦР-ПДРФ, мутации R501X – праймеры (FilH1F3/RPT1P6): CACGGAAAGGCTGGGCTGA/ACCTGAGTGTCCAGACCTATT. Для выявления мутации 2282del4 использованы праймеры RPT1P7/RPT2P1: AATAAGTCTGGACACTCAGGT/GGGAGGACTCAGACTGTTT (Palmer, et al., 2006). Объем амплификационной смеси – 30 мкл. ПЦР проводили с использованием амплификатора «Терцик» (Россия). Для выявления мутации 2282del4 использовали температурный режим: 95 °С – 30 с, 57 °С – 30 с, 72 °С – 1 мин; мутации R501X: 95 °С – 30 с, 58 °С – 30 с, 72 °С – 40 с. Фрагмент гена FLG, используемый для определения мутации R501X, имел длину 312 пар нуклеотидов (п. н.), для мутации 2282del4 811 п. н.

Продукты амплификации определяли по результатам электрофореза в 1% агарозном геле. Ампликон FLG R501X подвергали воздействию рестриктазы Hin1II (NlaIII) (Fermentas, Литва), разрезающей сайт с последовательностью CATG. Рестриктазу добавляли в расчете 3 единицы на 30 мкл смеси после ПЦР. Ампликон FLG 2282del4 обрабатывали рестриктазой AdeI (DraIII) (Fermentas, Литва), разрезающей сайт с последовательностью CACNNN GTG. Рестриктазу добавляли в расчете 3 единицы на 30 мкл смеси после ПЦР. Для проведения рестрикции образцы инкубировали в течение ночи при 37 °С (Palmer, et al., 2006). Определение генотипов проводили по результатам электрофореза в 3% агарозном геле. Для определения молекулярной массы фрагментов ДНК использовались стандартные маркеры молекулярной массы (100–1500 п. н.).

Гипотезу о равенстве частот аллелей в группах больных и здоровых мужчин и женщин, а также равенстве распределений фактических и теоретических рядов генотипов проверяли с помощью критерия χ2 на уровне значимости 0,05 (Гланц, 1998).

Результаты исследования и их обсуждение

Рестриктаза Hin1II (NlaIII) разрезает фрагмент гена FLG R501X на 3 или 2 фрагмента в зависимости от наличия или отсутствия мутации. Если мутация присутствует, то ампликон FLG разрезается на три фрагмента, а если отсутствует, то на два. Рестриктаза AdeI (DraIII) не разрезает ампликон FLG 2282del4, если во фрагменте нет делеции. При наличии делеции во фрагменте появляется сайт для AdeI, происходит расщепление ампликона эндонуклеазой, и на электрофореграмме это проявляется в виде появления двух полосок ДНК.

В результате проведенного анализа указанных выше мутаций в гене FLG были выявлены рестрикционные фрагменты, принадлежащие трем генотипам – нормальному, гетерозиготному и гомозиготному по исследуемым мутациям (рис. 1, 2).

Zueva_Ivanova_1_Spec_2012_1.jpg

Zueva_Ivanova_1_Spec_2012_2.jpg

В контрольной группе мутация R501X в гетерозиготном состоянии была обнаружена у одной женщины и одного мужчины (2,1%). Мутация R501X в гетерозиготном состоянии чаще встречалась в общей группе больных мужчин (6,8%), мужчин, страдающих экземой (5,4%), АД (13,3%) и аллергическим дерматитом (9,1%), по сравнению с контрольной группой (2,7%, р<0,01). Гомозиготы по данной мутации не выявлены (табл. 1).

Мутация 2282del4 в гетерозиготном состоянии в контрольной группе была обнаружена у одного мужчины, что составило по группе в целом 1%, а в группе мужчин – 2,7%. Частота этой делеции в гетерозиготном состоянии у больных была в несколько раз выше (табл. 2). В общей группе больных данная мутация встречалась примерно у 10%, а у больных экземой – 6%. Самые высокие показатели наблюдались в группе пациентов с АД (40% – у мужчин, 17% – у женщин, 25% – в целом, р<0,01) и аллергическим дерматитом (9% – мужчины, 12% – женщины, 11% – в целом, р<0,01).

Таблица 1. Распределение генотипов по мутации FLG R501X у больных с аллергодерматозами и среди здоровых людей
Группа
Пол
n
Генотипы FLG R501X
Wt/wt
wt/R501X
R501X/R501X
f
%
f
%
f
%
Контрольная
Мужской
Женский
Всего
37
59
96
36
58
94
97,3
98,3
97,9
1
1
2
2,7
1,7
2,1
0
0
0
0,0
0,0
0,0
Пациенты с аллергодерматозами
Мужской
Женский
Всего
118
144
262
110
142
252
93,2
98,6
96,2
8
2
10
6,8
1,4
3,8
0
0
0
0,0
0,0
0,0
Пациенты с экземой
Мужской
Женский
Всего
92
85
177
87
83
170
94,6
97,6
96,0
5
2
7
5,4
2,4
4,0
0
0
0
0,0
0,0
0,0
Пациенты с АД
Мужской
Женский
Всего
15
30
45
13
30
43
86,7
100,0
95,6
2
0
2
13,3
0,0
4,4
0
0
0
0,0
0,0
0,0
Пациенты с аллергическим дерматитом
Мужской
Женский
Всего
11
25
36
10
25
35
90,9
100,0
97,2
1
0
1
9,1
0,0
2,8
0
0
0
0,0
0,0
0,0
Примечание: n – количество обследованных; f – частота; wt/wt – нормальный генотип; wt/R501X – гетерозигота по мутации R501X; R501X/R501X – гомозигота по мутации R501X.

Таблица 2. Распределение генотипов по мутации FLG 2282del4 у больных с аллергодерматозами и среди здоровых людей
Группа
Пол
n
Генотипы FLG 2282del4
wt/wt
wt/2282del4
2282del4/2282del4
f
%
f
%
f
%
Контрольная
Мужской
Женский
Всего
37
59
96
36
59
95
97,3
100,0
99,0
1
0
1
2,7
0,0
1,0
0
0
0
0,0
0,0
0,0
Пациенты с аллергодерматозами
Мужской
Женский
Всего
118
144
262
105
130
235
89,0
90,3
89,7
12
14
26
10,2
9,7
9,9
1
0
1
0,8
0,0
0,4
Пациенты с экземой
Мужской
Женский
Всего
92
85
177
87
79
166
94,6
92,9
93,8
5
6
11
5,4
7,1
6,2
0
0
0
0,0
0,0
0,0
Пациенты с АД
Мужской
Женский
Всего
15
30
45
8
25
33
53,3
83,3
73,3
6
5
11
40,0
16,7
24,5
1
0
1
6,7
0,0
2,2
Пациенты с аллергическим дерматитом
Мужской
Женский
Всего
11
25
36
10
22
32
90,9
88,0
88,9
1
3
4
9,1
12,0
11,1
0
0
0
0,0
0,0
0,0
Примечание: n – количество обследованных; f – частота; wt/wt – нормальный генотип; wt/2282del4 – гетерозигота по мутации 2282del4; 2282del4/2282del4 – гомозигота по мутации 2282del4.

Кроме того, пациент Х. (мужчина 45 лет), у которого присутствовала мутация 2282del4 в гомозиготном состоянии, имел наиболее тяжелую форму АД по сравнению с другими больными (как с мутациями в гетерозиготном состоянии, так и без мутаций).

Таким образом, гетерозиготы по мутациям 2282del4 и R501X значительно чаще встречались в основной группе. Это может свидетельствовать о том, что наличие этих двух мутаций с потерей функции гена повышает риск возникновения аллергодерматозов. Наличие данных мутаций может являться диагностическим критерием выявления предрасположенности к атопическому и аллергическому дерматиту и экземе.

Литература

1. Бакстон П. Дерматология. – М.: Бином, 2005. – С. 29–38 /Bakston P. Dermatologiya. – M.: Binom, 2005. – S. 29–38.
2. Гланц С. Медико-биологическая статистика. – М.: Практика, 1998. – 459 с. / Glants S. Mediko-biologicheskaya statistika. – M.: Praktika, 1998. – 459 s.
3. Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генной инженерии. Молекулярное клонирование / Пер. с англ. – М.: Мир, 1984. – 480 с. / Maniatis T., Frich E., Sembruk Dzh. Metody gennoy inzhenerii. Molekulyarnoye klonirovaniye / Per. s angl. – M.: Mir, 1984. – 480 s.
4. Elias P.M., Schmuth M. Abnormal skin barrier in the etiopathogenesis of atopic dermatitis // Curr. Opin. Allergy Clin. Immunol. – 2009. – Vol. 9, № 5. – P. 437–446.
5. Howell М., Eui Kim В., Gao Р., Audrey V. Cytokine modulation of atopic dermatitis filaggrin skin expression // J Allergy Clin. Immunol. – 2007. – № 7. – P. 150–155.
6. Hubiche T., Ged C., Benard A., Léauté-Labréze C. et al. Analysis of SPINK 5, KLK 7 and FLG genotypes in a French atopic dermatitis cohort // Acta Derm. Venereol. – 2007. – Vol. 87, № 6. – P. 499–505.
7. Meyer–Hoffert U. Reddish, scaly, and itchy: how proteases and their inhibitors contribute to inflammatory skin diseases // Arch. Immunol. Ther. Exp. – 2009. – Vol. 52, № 8. – P. 345–354.
8. Palmer C.N., Irvine A.D., Terron-Kwiatkowski A., Zhao Y. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis // Nat Genet. – 2006. – Vol. 38, № 2. – P. 441–446.
9. Sandilands А., Sutherland С., Irvine А.D., McLean W.H. Filaggrin in the frontline: role in skin barrier function and disease // J Cell Sci. – 2009. – Vol. 122, № 9. – P. 1285–1294.
10. Walley A.J., Chavanas S., Moffatt M.F. Gene polymorphism in Netherton and common atopic disease // Nat. genetics. – 2001. – Vol. 29, № 2. – P. 175–178.

Поделиться с друзьями:

Книги

сборник - Гиперчувствительность к лекарственным препаратам. Руководство для врачей
сборник - Спадкові захворювання шкіри
сборник - Герпесвірусні нейроінфекції  людини
сборник - Атлас: герпесвірусні нейроінфекцїї
сборник - Дитяча дерматовенерологія
сборник - Иммунодефицитные болезни человека
сборник - Хвороби шкіри жінок у віковому аспекті
сборник - Клиника, диагностика и лечение герпетических инфекций человека: руководство для врачей
сборник - Клиническая иммунология и аллергология